Excisão de sequências flanqueadoras de DNA pelo R

Ver o tópico anterior Ver o tópico seguinte Ir em baixo

Excisão de sequências flanqueadoras de DNA pelo R

Mensagem  AlainVBarros em Ter Jul 29, 2014 10:31 am

Fala galera, sou noob no R e queria uma dica de como fazer a seguinte função, ou se a mesma já existe:

Eu trabalho com análise de seqüências de DNA, porém, estas possuem outras pequenas seqüências que as flanqueiam, Ex:

TTAGGGTTAGGGGCATTCGTCAGCTACTAGATGCAGGGTCGGGTTAGGGTT

Há alguma forma de eu entrar com minhas seqüências ( todas em uma tabela por ex. ) e retirar essas seqüências flanqueadoras (vermelho) já que estas são comuns a todos os meus dados, e gerar uma nova tabela só com as seqüências de interesse, ao invés de fazer isso seqüência por seqüência ?

Desde já, agradeço!

AlainVBarros

Mensagens : 2
Data de inscrição : 29/07/2014

Ver perfil do usuário

Voltar ao Topo Ir em baixo

Ver o tópico anterior Ver o tópico seguinte Voltar ao Topo

- Tópicos similares

 
Permissão deste fórum:
Você não pode responder aos tópicos neste fórum